Skip to main content

Sanger sequencing and genotyping

Sequencing full service

For ordering full sequencing You'll have to provide us with:

  • Template DNA - 300-500 ng of plasmid per reaction, 30-50 ng PCR product per reaction. We can use up to 5,7 μL of template DNA in each reaction mixture
  • Primers - for one sequencing reaction we require 0,3 μL of 10 µM (10 pmol/mL) primer (but please send no less than 2-3 μL)
  • Complete the order form and send it to kapillaar@ebc.ee;
    • print it out as well and send it with DNA and primers to the address:
      Institute of Genomics Core Facility
      University of Tartu
      Riia mnt 23b-302
      51010 Tartu, ESTONIA
    • Or bring your samples to the freezer by the security table at our building's Riia street entrance.

 

We offer the following universal primers: 

Primer   Sequence   ap
ITS4   TCCTCCGCTTATTGATATGC   20
ITS5   GGAAGTAAAAGTCGTAACAAGG   22
M13F   GTAAAACGACGGCCAGT   17
M13F-pUC(-40)    GTTTTCCCAGTCACGAC   17
M13R   GCGGATAACAATTTCACACAGG   22
M13R-pUC(-40)   CAGGAAACAGCTATGAC   17
pJET1.2F   CGACTCACTATAGGGAGAGCGGC   23
pJET1.2R   AAGAACATCGATTTTCCATGGCAG   24
SP6   ATTTAGGTGACACTATAG   18
T3   ATTAACCCTCACTAAAG   17
T7   AATACGACTCACTATAG   17
T7promoter   TAATACGACTCACTATAGGG   20
T7terminator   GCTAGTTATTGCTCAGCGG   19

Ready-to-load sequencing

We also analyze ready-to-load sequencing reaction products. Products must be manufactured using the BigDye® Terminator v3.1 (in exceptional cases You can also use BigDye® Terminator v1.1) and diluted in 10 μL formamide (70% formamide or Applied Biosystems Hi-Di formamide).

There is no need to fill the order form, please send us the list of sample names in *.txt file, along with invoice recipient.

Fragment analysis

We use a variety of fragment analysis methods - microsatellite analysis, MLPA analysis etc. The client generally prepares the samples to a ready-to-load state, we perform the denaturation before analysis. There is no need to fill the order form, please send us the list of sample names in *.txt file, along with invoice recipient and used dye set.

You can use following dye combinations:

Filter Dye set Blue Green Yellow Red Size standard
D DS-30 6FAM HEX NED   ROX
G5 DS-33 6FAM VIC NED PET LIZ
E5 DS-02 dR110 dR6G dTAMRA dROX LIZ
4Dye Custom 6FAM HEX TAMRA   ROX
5Dye Custom FL JOE TMR-ET CXR-ET WEN
F Promega FL JOE TMR   CXR

Note that the size standard is added to each sample. For best quality results be sure to use Applied Biosystems Hi-Di Formamide as a loading solution (minimum 10 μL).

Minimal order size is 16 samples.

Fast processing service

With a fast processing service, we guarantee the results by the next working day. Note that the samples must arrive by 9 am if You want to receive results within the same working day. 

For ordering a fast processing service, please write it to the "Comments" section in the order form.