Skip to main content

Sangeri sekveneerimine ja kapillaarelektroforees

Oleme alates 2006. aastast pakkunud erinevaid sekveneerimise ning genotüüpimise teenuseid. Meile teadaolevalt oleme Eestis ainus Sanger-tüüpi sekveneerimise teenusepakkuja. 

Teenused jaotuvad kaheks - DNA sekveneerimise täisteenuseks ja kapillaarelektroforeesiks. Esimese puhul viime läbi sekveneerimisreaktsiooni ja sellele järgneva uurimismaterjali ettevalmistamise, teise puhul lähevad tellija poolt ette valmistatud materjalid otse analüsaatorisse.

Analüüse viime läbi Applied Biosystemsi kapillaarelektroforeesimasinatel.

Lae alla tellimisleht

PS! Kiirteenuse tellimiseks peavad materjalid jõudma laborisse hiljemalt kl 9 hommikul.

DNA sekveneerimise täisteenus

DNA sekveneerimise täisteenuse puhul saadab tellija meile oma uuritava PCR-i produkti või plasmiidi ning sekveneerimispraimerid (või valib praimeri meie poolt pakutavate universaalpraimerite hulgast). Meetodi põhimõttega saate tutvuda siin.  

Sekveneerimist viime läbi Applied Biosystems 3130xl Genetic Analyzer'il ja kahel Applied Biosystems 3730xl DNA Analyzer masinal. 

  • Saata matriits-DNA - plasmiidi puhul 300-500 ng reaktsiooni kohta, PCR-i produkti puhul 30-50 ng reaktsiooni kohta. Igas reaktsioonisegus saame kasutada kuni 5,7 μL DNA-d 
  • Saata praimerid - 10 μM (ehk 10 pmol/μL) kontsentratsiooniga praimerit kulub ühe reaktsiooni peale 0,3 μL (kuid palume saata mitte vähem kui 2-3 μL) 
  • Täita tellimisleht, saata aadressile kapillaar@ebc.ee, samuti trükkida välja ning pakkida proovidega kaasa.

Pakk DNA, praimerite ning tellimislehega saata:

TÜ GI tuumiklabor
Riia mnt 23b-302
51010 Tartu

Kui toote saadetise ise ära, siis ootame neid Riia maantee poolse valvuri juures olevasse külmkappi (kapp märgistatud sildiga "Sekveneerimine").

Praimer Järjestus ap
ITS4 TCCTCCGCTTATTGATATGC 20
ITS5 GGAAGTAAAAGTCGTAACAAGG 22
M13F GTAAAACGACGGCCAGT 17
M13F-pUC(-40)  GTTTTCCCAGTCACGAC 17
M13R GCGGATAACAATTTCACACAGG 22
M13R-pUC(-40) CAGGAAACAGCTATGAC 17
pJET1.2F CGACTCACTATAGGGAGAGCGGC 23
pJET1.2R AAGAACATCGATTTTCCATGGCAG 24
SP6 ATTTAGGTGACACTATAG 18
T3 ATTAACCCTCACTAAAG 17
T7 AATACGACTCACTATAG 17
T7promoter TAATACGACTCACTATAGGG 20
T7terminator GCTAGTTATTGCTCAGCGG 19

 

  • Lisateenusena pakume PCR-i produktide ensümaatilist puhastamist, mida viime läbi Thermo Scientific FastAP Thermosensitive Alkaline Phosphatase'i ja Exonuclease I-ga.
  • Ühtlasi on võimalik tellida kiirteenust, mille puhul garanteeritakse Teile tulemuste kättesaamine järgmise tööpäeva jooksul. Kui soovite kiirtellimuse vastuseid sama tööpäeva jooksul, siis peavad proovid olema meieni jõudnud hiljemalt kell 9.00. Kiirteenuse tellimiseks tehke sellekohane märge saatelehe lahtrisse "Märkused". 
  • Samuti pakume keerulise matriitsi sekveneerimist, mida soovitame kasutada nukleotiidseid kordusi sisaldava, GC-rikka või sekundaarstruktuure moodustava materjali puhul. Keerulise sekveneerimise tellimiseks tehke sellekohane märge saatelehe lahtrisse "Märkused". 

Kapillaarelektroforees

Kapillaarelektroforeesi viime läbi Applied Biosystems 3130xl Genetic Analyzer masinaga. 

1. Valmis reaktsioonide sekveneerimine

Sekveneerime ka teie poolt valmistatud reaktsiooniprodukte. Produktid peavad olema valmistatud kasutades BigDye® Terminator v3.1 (erandjuhul ja sellekohase märkega ka BigDye® Terminator v1.1) ensüümimiksi, puhastatud üleliigsetest praimeritest ja nukleotiididest ning suspendeeritud 10 μL formamiidis (70% formamiid või Applied Biosystemsi Hi-DiTM formamiid).

Tellimuse esitamiseks pole saatelehte vaja täita.

Saatke proovide nimekiri kapillaar@ebc.ee aadressile *.txt failina, lisades juurde ka teenuse eest tasuja.

2. Fragmentanalüüs

Peale sekveneerimise viime läbi ka mikrosatelliitide analüüsi, MLPA analüüsi, genotüpeerimist (Applied Biosystems SNaPshot Multiplex System) jm.

Tellimuse esitamiseks pole saatelehte vaja täita, saatke proovide nimekiri kapillaar@ebc.ee aadressile *.txt failina, lisades juurde ka teenuse eest tasuja ning kasutatud märgiste kombinatsioon.

Teenust saab tellida ka nii, et kasutate meie poolt pakutavat ROX 500LIZ 500 või LIZ 1200 pikkusmarkerit. 

Üldjuhul valmistab klient uuritava materjali ette kuni analüüsi läbiviimiseni, meie teostame vaid proovide denatureerimist vahetult enne analüüsi. 

Võimalikud värvikombinatsioonid: 

Filter Dye set Sinine Roheline Kollane Punane Pikkusmarker
D DS-30 6FAM HEX NED   ROX
G5 DS-33 6FAM VIC NED PET LIZ
E5 DS-02 dR110 dR6G dTAMRA dROX LIZ
4Dye Custom 6FAM HEX TAMRA   ROX
5Dye Custom FL JOE TMR-ET CXR-ET WEN
F Promega FL JOE TMR   CXR

NB! Pikkusmarker lisatakse igasse proovi. Fragmentanalüüsi proovide resuspendeerimisel tuleb kvaliteetse tulemuse saamiseks kasutada Applied Biosystemsi Hi-Di formamiidi.

Minimaalne tellimuse suurus on 16 proovi. 

Fragmentanalüüsi meetodite laia valiku tõttu palume enne esimese tellimuse tegemist meiega aadressil kapillaar@ebc.ee ühendust võtta, et plaanid läbi rääkida.